Skip to main content
Addgene
Open Menu

pTrans_9xD3B_Cluc_Norm
(Plasmid #68415)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 68415 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 68415-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 68415-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pNEB193
  • Backbone manufacturer
    NEB
  • Vector type
    Mammalian Expression, Luciferase
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cypridina Luciferase-2A-Venus YFP
  • Mutation
    YFP: M153T,V163A,S175G ("Venus") YFP Variant
  • Promoter minimalCMV

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Reporters are separated by 2A "self-cleaving" peptides. The reporter cassette is under the control of a minimal CMV promoter, preceeded by a casette of nine (ATCTAGATCGCCCGTCCCCT)AGG sites

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTrans_9xD3B_Cluc_Norm was a gift from John Rinn (Addgene plasmid # 68415 ; http://n2t.net/addgene:68415 ; RRID:Addgene_68415)

  • For your References section:

    Multiplexable, locus-specific targeting of long RNAs with CRISPR-Display. Shechner DM, Hacisuleyman E, Younger ST, Rinn JL. Nat Methods. 2015 Jul;12(7):664-70. doi: 10.1038/nmeth.3433. Epub 2015 Jun 1. 10.1038/nmeth.3433 PubMed 26030444
Related items:
Commonly requested with: