pCSDest2-SpCas9-WT-NLS-3XHA-NLS-ZFP_TS2
(Plasmid
#69225)
-
PurposeExpresses wild type SpCas9 fused to ZFP-TS2 in mammalian cells
-
Depositing Lab
-
Depositing OrganizationUniversity of Massachusetts, Worcester
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 69225 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 69225-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 69225-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCSDest2-SpCas9-NLS-3XHA-NLS
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTS2 ZFP
-
SpeciesSynthetic
-
Tag
/ Fusion Protein
- NLS-3XHA-NLS (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BspEI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CACAGGGATAAGCCCATCAG
- 3′ sequencing primer T3
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 69225-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 69225-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCSDest2-SpCas9-WT-NLS-3XHA-NLS-ZFP_TS2 was a gift from Scot Wolfe (Addgene plasmid # 69225 ; http://n2t.net/addgene:69225 ; RRID:Addgene_69225) -
For your References section:
DNA-binding-domain fusions enhance the targeting range and precision of Cas9. Bolukbasi MF, Gupta A, Oikemus S, Derr AG, Garber M, Brodsky MH, Zhu LJ, Wolfe SA. Nat Methods. 2015 Oct 19. doi: 10.1038/nmeth.3624. 10.1038/nmeth.3624 PubMed 26480473