Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pCSDest2-SpCas9-NLS-3XHA-NLS-Zif268
(Plasmid #69219)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 69219 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Zif268
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    356
  • Entrez Gene
    Egr1 (a.k.a. A530045N19Rik, ETR103, Egr-1, Krox-1, Krox-24, Krox24, NGF1-A, NGFI-A, NGFIA, TIS8, Zenk, Zfp-6, Zif268, egr)
  • Tag / Fusion Protein
    • NLS-3XHA-NLS

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BspEI (not destroyed)
  • 3′ cloning site SnaBI (not destroyed)
  • 5′ sequencing primer CACAGGGATAAGCCCATCAG
  • 3′ sequencing primer T3
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCSDest2-SpCas9-NLS-3XHA-NLS-Zif268 was a gift from Scot Wolfe (Addgene plasmid # 69219 ; http://n2t.net/addgene:69219 ; RRID:Addgene_69219)
  • For your References section:

    DNA-binding-domain fusions enhance the targeting range and precision of Cas9. Bolukbasi MF, Gupta A, Oikemus S, Derr AG, Garber M, Brodsky MH, Zhu LJ, Wolfe SA. Nat Methods. 2015 Oct 19. doi: 10.1038/nmeth.3624. 10.1038/nmeth.3624 PubMed 26480473