Skip to main content

Myog'-2A-mCherryNLS-PGK-Puro
(Plasmid #69548)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 69548 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 69548-D50 50 μg of DNA in Tris buffer $495
DNA 69548-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    PCR2.1
  • Backbone manufacturer
    Invitrogen
  • Total vector size (bp) 7948
  • Vector type
    Mouse Targeting
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    2A-mCherry-NLS
  • Alt name
    mCherry
  • Species
    Synthetic
  • Insert Size (bp)
    819
  • Tags / Fusion Proteins
    • PVT1-2A "skipping" peptide (N terminal on insert)
    • 2x nuclear localization signal (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site BsrGI (not destroyed)
  • 5′ sequencing primer cttccctgctggtctctgac
  • 3′ sequencing primer CACCATCGTGGAACAGTACG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Myogenin 5' homology arm
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    702
  • Mutation
    Silent V205V mutation in myogenin gene to prevent Cas9-generated double-strand break.
  • GenBank ID
    NC_000067.6

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer M13-Rev
  • 3′ sequencing primer AAGCGCATGAACTCCTTGAT
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    Myogenin 3' homology arm
  • Alt name
    Myog
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    675
  • GenBank ID
    NC_000067.6
  • Entrez Gene
    Myog (a.k.a. MYF4, bHLHc3, myo)

Cloning Information for Gene/Insert 3

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer taggtccctcgaagaggttcacta
  • 3′ sequencing primer caaggcgattaagttgggtaacgccag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Myog'-2A-mCherryNLS-PGK-Puro was a gift from Charles Gersbach (Addgene plasmid # 69548 ; http://n2t.net/addgene:69548 ; RRID:Addgene_69548)