-
Purposeconditional expression of a diphtheria toxin receptor (DTR)–GFP fusion protein
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 124364 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 | |
AAV2 | 124364-AAV2 | Virus (100 µL at titer ≥ 5×10¹² vg/mL) and Plasmid. | $380 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAM-FLEX
- Backbone size w/o insert (bp) 5650
- Total vector size (bp) 7084
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameDTR-GFP
-
Alt nameDiphtheria Toxin Receptor - GFP fusion protein
-
Alt nameSimian DTR
-
Insert Size (bp)1365
- Promoter Chicken B-actin
-
Tag
/ Fusion Protein
- GFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (destroyed during cloning)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer TGGTGCAGATGAACTTCAGG
- 3′ sequencing primer CCAAAGGGAGATCCGACTCG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byDTR was a gift of Thorsten Buch (University of Cologne, Germany)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Information for AAV2 (Catalog # 124364-AAV2) ( Back to top )
Purpose
Ready-to-use AAV2 particles produced from pAAV-FLEX-DTR-GFP (#124364). In addition to the viral particles, you will also receive purified pAAV-FLEX-DTR-GFP plasmid DNA.
CBA-driven, Cre-dependent expression of DTR-GFP. These AAV preparations are suitable purity for injection into animals.Delivery
- Volume 100 µL
- Titer ≥ 5×10¹² vg/mL
- Pricing $350 USD for preparation of 100 µL virus + $30 USD for plasmid.
- Storage Store at -80℃. Thaw just before use and keep on ice.
- Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.
Viral Production & Use
- Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV2 cap gene
- Buffer PBS + 0.001% Pluronic F-68 + 200 mM NaCl
- Serotype AAV2
- Purification Iodixanol gradient ultracentrifugation
- Reporter Gene GFP (Cre-dependent)
Biosafety
Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Viral Quality Control
- Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
- Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.
Visit our viral production page for more information.
Addgene Comments
Using FLEX vectors in vivo: LoxP sites in FLEX plasmids are known to recombine during DNA amplification and viral vector production, which may result in a minority of Cre-activated (i.e., "flipped") viral vectors. Addgene has measured this occurs in 0.1-0.8% of viral particles in our typical production protocol. This can lead to a small number of cells exhibiting Cre-independent transgene expression in vivo. To address this, it is necessary to optimize the injection volume and viral titer to find the optimal AAV dosage required for Cre-dependent transgene expression and function in vivo. This may include reducing the viral particle dosage in order to reduce the likelihood of Cre-independent expression.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-FLEX-DTR-GFP was a gift from Eiman Azim & Thomas Jessell (Addgene plasmid # 124364 ; http://n2t.net/addgene:124364 ; RRID:Addgene_124364)
For viral preps, please replace (Addgene plasmid # 124364) in the above sentence with: (Addgene viral prep # 124364-AAV2)
-
For your References section:
Skilled reaching relies on a V2a propriospinal internal copy circuit. Azim E, Jiang J, Alstermark B, Jessell TM. Nature. 2014 Apr 17;508(7496):357-63. doi: 10.1038/nature13021. Epub 2014 Feb 2. 10.1038/nature13021 PubMed 24487617