Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #58536)


Item Catalog # Description Quantity Price (USD)
Plasmid 58536 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 5604
  • Total vector size (bp) 6780
  • Vector type
    Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    Low Copy


  • Gene/Insert name
  • Alt name
    diphtheria toxin A
  • Insert Size (bp)
  • GenBank ID
    X00703.1 AB610405.1
  • Entrez Gene
    DIP_RS18250 (a.k.a. DIP_RS18250, DIP1414)
  • Promoter EF1a

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site BglII (not destroyed)
  • 5′ sequencing primer agcaacatagttaagaatac
  • 3′ sequencing primer cgagcttttggagtacgtcg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-mCherry-flex-dtA was a gift from Naoshige Uchida (Addgene plasmid # 58536 ; ; RRID:Addgene_58536)
  • For your References section:

    Galanin neurons in the medial preoptic area govern parental behaviour. Wu Z, Autry AE, Bergan JF, Watabe-Uchida M, Dulac CG. Nature. 2014 May 15;509(7500):325-30. doi: 10.1038/nature13307. 10.1038/nature13307 PubMed 24828191