pcDNA3.1(+) Laccase2 MCS-ZKSCAN1 548-1417 (No intron)
(Plasmid
#69898)
-
PurposeExpresses a miniature version of the ZKSCAN1 circular RNA in mammalian cells
-
Depositing Lab
-
Depositing OrganizationUniversity of Pennsylvania
Located in United States of America -
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 69898 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 69898-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 69898-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepcDNA3.1(+) Laccase2 MCS Exon Vector
- Backbone size w/o insert (bp) 6926
- Total vector size (bp) 7532
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameZKSCAN1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)650
-
MutationF169L in ZKSCAN1
-
Entrez Genestw (a.k.a. Dmel_CG42345, CG10398, CG10408, CG30437, CG32838, CG42345, Dmel\CG42345, Dmel_CG30437, Dmel_CG32838, Laccase2, MCO2, laccase2, str)
-
Entrez GeneZKSCAN1 (a.k.a. KOX18, PHZ-37, ZNF139, ZNF36, ZSCAN33)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PacI (not destroyed)
- 3′ cloning site SacII (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 69898-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 69898-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1(+) Laccase2 MCS-ZKSCAN1 548-1417 (No intron) was a gift from Jeremy Wilusz (Addgene plasmid # 69898 ; http://n2t.net/addgene:69898 ; RRID:Addgene_69898) -
For your References section:
Combinatorial control of Drosophila circular RNA expression by intronic repeats, hnRNPs, and SR proteins. Kramer MC, Liang D, Tatomer DC, Gold B, March ZM, Cherry S, Wilusz JE. Genes Dev. 2015 Oct 8. 10.1101/gad.270421.115 PubMed 26450910
Map uploaded by the depositor.
