Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pCas9_sgRNA_0
(Plasmid #70763)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 70763 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pNEBUC
  • Backbone manufacturer
    Weinzierl et al., 2002, Mol. Microbiol. 45
  • Total vector size (bp) 11105
  • Vector type
    self-replicating in Ustilago maydis, conferring carboxin resistance
  • Selectable markers
    carboxin resistance conferred by mutated ip gene

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    U6 promoter
  • Species
    Ustilago maydis
  • Insert Size (bp)
    826
  • Promoter U6 from Ustilago maydis

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site Acc651 (not destroyed)
  • 5′ sequencing primer TACGCCAAGCTTTAATACGTTCGTTCCG
  • 3′ sequencing primer GGTACGGGTACCGTTGTAGAATGGAATTTTG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    cas9
  • Species
    Synthetic
  • Insert Size (bp)
    5393
  • Mutation
    Streptococcus pyogenes gene codon-optimized for Ustilago maydis
  • Promoter synthetic otef promoter (Spellig et al., 1996, Mol. Gen. Genet. 252)
  • Tag / Fusion Protein
    • N-terminal NLS, C-terminal HA-tag +NLS (N terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer TACGCCAAGCTTTAATACGTTCGTTCCG
  • 3′ sequencing primer GTAAAACGACGGCCAG
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    tnos terminator
  • Species
    Agrobacterium tumefaciens
  • Insert Size (bp)
    291

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCas9_sgRNA_0 was a gift from Regine Kahmann (Addgene plasmid # 70763 ; http://n2t.net/addgene:70763 ; RRID:Addgene_70763)
  • For your References section:

    Genome editing in Ustilago maydis using the CRISPR-Cas system. Schuster M, Schweizer G, Reissmann S, Kahmann R. Fungal Genet Biol. 2015 Sep 11. pii: S1087-1845(15)30025-6. doi: 10.1016/j.fgb.2015.09.001. 10.1016/j.fgb.2015.09.001 PubMed 26365384