-
PurposeA human codon-optimized SpCas9 fused to first 110 amino acids of human GEMININ and chimeric guide RNA expression plasmid
-
Depositing Lab
-
Depositing OrganizationUniversity of Texas MD Anderson Cancer Center
Located in United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 71707 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 71707-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 71707-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepX330-U6-Chimeric_BB-CBh-hSpCas9
-
Backbone manufacturerZhang lab, Addgene plasmid 42230
- Total vector size (bp) 8854
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehumanized S. pyogenes Cas9 fused to human Geminin
-
Alt namehSpCas9-hGem(1/110)
-
Alt namehCas9-hGem(1/110)
-
Alt nameGEMININ
-
SpeciesH. sapiens (human)
-
Insert Size (bp)4614
-
Entrez GeneGMNN (a.k.a. Gem, MGORS6)
- Promoter CBh
-
Tags
/ Fusion Proteins
- 3xFLAG (N terminal on insert)
- hGEM(1/110) (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer pCBhProF (AGGGATGGTTGGTTGGTGGG)
- 3′ sequencing primer CCAATCCTCCCCCTTGCTGT or BGH-rev
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 71707-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 71707-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX330-U6-Chimeric_BB-CBh-hSpCas9-hGem(1/110) was a gift from Giulio Draetta (Addgene plasmid # 71707 ; http://n2t.net/addgene:71707 ; RRID:Addgene_71707) -
For your References section:
Post-translational Regulation of Cas9 during G1 Enhances Homology-Directed Repair. Gutschner T, Haemmerle M, Genovese G, Draetta GF, Chin L. Cell Rep. 2016 Feb 3. pii: S2211-1247(16)00040-1. doi: 10.1016/j.celrep.2016.01.019. 10.1016/j.celrep.2016.01.019 PubMed 26854237