Skip to main content

pX330-U6-Chimeric_BB-CBh-hSpCas9-hGem(1/110)
(Plasmid #71707)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 71707 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 71707-D50 50 μg of DNA in Tris buffer $495
DNA 71707-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pX330-U6-Chimeric_BB-CBh-hSpCas9
  • Backbone manufacturer
    Zhang lab, Addgene plasmid 42230
  • Total vector size (bp) 8854
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    humanized S. pyogenes Cas9 fused to human Geminin
  • Alt name
    hSpCas9-hGem(1/110)
  • Alt name
    hCas9-hGem(1/110)
  • Alt name
    GEMININ
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    4614
  • Entrez Gene
    GMNN (a.k.a. Gem, MGORS6)
  • Promoter CBh
  • Tags / Fusion Proteins
    • 3xFLAG (N terminal on insert)
    • hGEM(1/110) (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer pCBhProF (AGGGATGGTTGGTTGGTGGG)
  • 3′ sequencing primer CCAATCCTCCCCCTTGCTGT or BGH-rev
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX330-U6-Chimeric_BB-CBh-hSpCas9-hGem(1/110) was a gift from Giulio Draetta (Addgene plasmid # 71707 ; http://n2t.net/addgene:71707 ; RRID:Addgene_71707)
  • For your References section:

    Post-translational Regulation of Cas9 during G1 Enhances Homology-Directed Repair. Gutschner T, Haemmerle M, Genovese G, Draetta GF, Chin L. Cell Rep. 2016 Feb 3. pii: S2211-1247(16)00040-1. doi: 10.1016/j.celrep.2016.01.019. 10.1016/j.celrep.2016.01.019 PubMed 26854237