-
Purpose(Empty Backbone) All-in-one doxycycline inducible lentiviral vector for expression of one gene in combination with turbo GFP using the P2A self-cleaving peptide.
-
Depositing Lab
-
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 71783 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| Cloning Grade DNA | 71783-DNA.cg |
Back-ordered 2 µg of cloning grade DNA in Tris buffer |
1 | $115 | |
Backbone
-
Vector backbonepCW57.1
-
Backbone manufacturerBroad Insitute
- Backbone size (bp) 8405
-
Modifications to backbonepCW57-MCS1-2A-MCS2 was modified by the insertion of Turbo GFP into MCS1.
-
Vector typeMammalian Expression, Lentiviral ; Doxycycline inducible; P2A Self Cleaving Peptide; Turbo GFP reporter
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer pCW57.MCS_Seq_F CGTATGTCGAGGTAGGCGTG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byTurbo GFP was subcloned from pTurboGFP-PRL (evrogen; Cat# FP515).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Cloning Grade DNA (Catalog # 71783-DNA.cg)
Purpose
Cloning grade DNA is suitable for use in PCR, cloning reactions, or transformation into E. coli. The purity and amount is not suitable for direct transfections.
Delivery
- Amount 2 µg
- Guaranteed Concentration 100 ng/µl +/- 5 ng/µl
- Pricing $115 USD
- Storage DNA can be stored at 4℃ (short term) or -20℃ (long term).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Addgene has verified this plasmid using Next Generation Sequencing. Results are available here
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCW57-GFP-2A-MCS was a gift from Adam Karpf (Addgene plasmid # 71783 ; http://n2t.net/addgene:71783 ; RRID:Addgene_71783) -
For your References section:
Pan-Cancer Analyses Reveal Genomic Features of FOXM1 Overexpression in Cancer. Barger CJ, Branick C, Chee L, Karpf AR. Cancers (Basel). 2019 Feb 21;11(2). pii: cancers11020251. doi: 10.3390/cancers11020251. 10.3390/cancers11020251 PubMed 30795624