pCW57-MCS1-P2A-MCS2 (Hygro)
(Plasmid #80922)

• Purpose: (Empty Backbone) All-in-one doxycycline inducible lentiviral vector for expression of one or two genes using the P2A self-cleaving peptide.
• Depositing Lab: Adam Karpf
• Publication: Barger et al Cancers (Basel). 2019 Feb 21;11(2). pii: cancers11020251. doi: 10.3390/cancers11020251.

Backbone

• Vector backbone: pCW57.1
• Backbone manufacturer: Broad Insitute
• Backbone size (bp): 8158
• Modifications to backbone: pCW57-MCS1-2A-MCS2 was modified by replacing puromycin with hygromycin.
• Vector type: Mammalian Expression, Lentiviral ; Doxycycline inducible; P2A Self Cleaving Peptide
• Promoter: TRE
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: pCW57.MCS_Seq_F CGTATGTCGAGGTAGGCGTG

Resource Information

• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Information for Cloning Grade DNA (Catalog # 80922-DNA.cg) ( Back to top )

Purpose

Cloning grade DNA is suitable for use in PCR, cloning reactions, or transformation into E. coli. The purity and amount is not suitable for direct transfections.

Delivery

• Amount: 2 µg
• Guaranteed Concentration: 100 ng/µl +/- 5 ng/µl
• Pricing: $105 USD
• Storage: DNA can be stored at 4℃ (short term) or -20℃ (long term).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Addgene has verified this plasmid using Next Generation Sequencing. Results are available here