-
Purpose(Empty Backbone) All-in-one doxycycline inducible lentiviral vector for expression of one or two genes using the P2A self-cleaving peptide.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 89180 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| Cloning Grade DNA | 89180-DNA.cg |
Back-ordered 2 µg of cloning grade DNA in Tris buffer |
1 | $115 | |
Backbone
-
Vector backbonepCW57.1
-
Backbone manufacturerBroad Insitute
- Backbone size (bp) 7943
-
Modifications to backbonepCW57-MCS1-2A-MCS2 was modified by replacing puromycin-T2A-rtTA with rtTA-T2A-neomycin.
-
Vector typeMammalian Expression, Lentiviral ; Doxycycline inducible; P2A Self Cleaving Peptide
- Promoter TRE
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer pCW57.MCS_Seq_F CGTATGTCGAGGTAGGCGTG
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Cloning Grade DNA (Catalog # 89180-DNA.cg)
Purpose
Cloning grade DNA is suitable for use in PCR, cloning reactions, or transformation into E. coli. The purity and amount is not suitable for direct transfections.
Delivery
- Amount 2 µg
- Guaranteed Concentration 100 ng/µl +/- 5 ng/µl
- Pricing $115 USD
- Storage DNA can be stored at 4℃ (short term) or -20℃ (long term).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Addgene has verified this plasmid using Next Generation Sequencing. Results are available here
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCW57-MCS1-P2A-MCS2 (Neo) was a gift from Adam Karpf (Addgene plasmid # 89180 ; http://n2t.net/addgene:89180 ; RRID:Addgene_89180)