-
Purpose(Empty Backbone) All-in-one doxycycline inducible lentiviral vector for expression of one gene in combination with turbo RFP using the P2A self-cleaving peptide.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 89182 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCW57.1
-
Backbone manufacturerBroad Insitute
- Backbone size (bp) 8636
-
Modifications to backbonepCW57-MCS1-2A-MCS2 (Neo) was modified by the insertion of Turbo RFP into MCS1.
-
Vector typeMammalian Expression, Lentiviral ; Doxycycline inducible; P2A Self Cleaving Peptide
- Promoter TRE
-
Selectable markersNeomycin (select with G418) ; Turbo RFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer pCW57.MCS_Seq_F CGTATGTCGAGGTAGGCGTG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCW57-RFP-P2A-MCS (Neo) was a gift from Adam Karpf (Addgene plasmid # 89182 ; http://n2t.net/addgene:89182 ; RRID:Addgene_89182) -
For your References section:
Co-regulation and function of FOXM1/RHNO1 bidirectional genes in cancer. Barger CJ, Chee L, Albahrani M, Munoz-Trujillo C, Boghean L, Branick C, Odunsi K, Drapkin R, Zou L, Karpf AR. Elife. 2021 Apr 23;10. pii: 55070. doi: 10.7554/eLife.55070. 10.7554/eLife.55070 PubMed 33890574