Skip to main content

pTT3 Unc5D-FLAG
(Plasmid #72197)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 72197 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pTT3
  • Backbone manufacturer
    Yves Durocher, National Research Council of Canada-Biotechnology Research Institute
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Unc5d
  • Alt name
    Unc5h4
  • Alt name
    NCBI gene ID 210801; Reference sequence XM_006509055.3
  • Species
    M. musculus (mouse)
  • GenBank ID
    XM_006509055.3
  • Entrez Gene
    Unc5d (a.k.a. D930029E11Rik, Unc5h4, mKIAA1777)
  • Promoter CMV
  • Tag / Fusion Protein
    • FLAG (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site SpeI (destroyed during cloning)
  • 5′ sequencing primer CAGTTTCCAAAAACGAGGAGG
  • 3′ sequencing primer TATGTCCTTCCGAGTGAGAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTT3 Unc5D-FLAG was a gift from Woj Wojtowicz (Addgene plasmid # 72197 ; http://n2t.net/addgene:72197 ; RRID:Addgene_72197)
  • For your References section:

    An extracellular biochemical screen reveals that FLRTs and Unc5s mediate neuronal subtype recognition in the retina. Visser JJ, Cheng Y, Perry SC, Chastain AB, Parsa B, Masri SS, Ray TA, Kay JN, Wojtowicz WM. Elife. 2015 Dec 3;4. pii: e08149. doi: 10.7554/eLife.08149. 10.7554/eLife.08149 PubMed 26633812