pcDNA3.1-CAG-LMO1 (GLuc-ChR2-EYFP)
(Plasmid
#72888)
-
Purposefusion protein of Gaussia luciferase, Channelrhodopsin-2, and enhanced yellow fluorescent protein (luminopsin) for bioluminescent optogenetics
-
Depositing Lab
-
Depositing OrganizationDuke University
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 72888 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 72888-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 72888-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepcDNA3.1
- Backbone size w/o insert (bp) 5427
- Total vector size (bp) 7759
-
Vector typeMammalian Expression, Bacterial Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGaussia luciferase, Channelrhodopsin-2, EYFP
-
Alt nameGLuc-ChR2-EYFP
-
Alt nameLMO1
-
SpeciesSynthetic; Gaussia princeps, Chlamydomonas
- Promoter CAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer AAGCTTGCCACCATGGGAGTCAAAGTT
- 3′ sequencing primer GGATCCCCGTCACCACCGGCCCCCTTGAT
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 72888-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 72888-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1-CAG-LMO1 (GLuc-ChR2-EYFP) was a gift from Ute Hochgeschwender (Addgene plasmid # 72888 ; http://n2t.net/addgene:72888 ; RRID:Addgene_72888) -
For your References section:
Light-emitting channelrhodopsins for combined optogenetic and chemical-genetic control of neurons. Berglund K, Birkner E, Augustine GJ, Hochgeschwender U. PLoS One. 2013;8(3):e59759. doi: 10.1371/journal.pone.0059759. Epub 2013 Mar 27. PONE-D-12-38868 [pii] PubMed 23544095