Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

AAV_NLS-dSaCas9-NLS-VPR
(Plasmid #68495)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 68495 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pX600-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA Plasmid #61592
  • Total vector size (bp) 8613
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    dSaCas9
  • Alt name
    dSauCas9
  • Species
    Synthetic; S. aureus
  • Insert Size (bp)
    4857
  • Promoter CMV
  • Tag / Fusion Protein
    • VPR (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CTACTACGAAGTGAATAGCAAGTGC
  • 3′ sequencing primer ACTCAGACAATGCGATGCAA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV_NLS-dSaCas9-NLS-VPR was a gift from George Church (Addgene plasmid # 68495 ; http://n2t.net/addgene:68495 ; RRID:Addgene_68495)
  • For your References section:

    Cas9 gRNA engineering for genome editing, activation and repression. Kiani S, Chavez A, Tuttle M, Hall RN, Chari R, Ter-Ovanesyan D, Qian J, Pruitt BW, Beal J, Vora S, Buchthal J, Kowal EJ, Ebrahimkhani MR, Collins JJ, Weiss R, Church G. Nat Methods. 2015 Sep 7. doi: 10.1038/nmeth.3580. 10.1038/nmeth.3580 PubMed 26344044