Skip to main content
Addgene
Open Menu

mHDAC7-Spliced (1-938) pEF6-V5 (MJS_014) [Edit]
(Plasmid #73267)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 73267 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 73267-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 73267-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pEF6/V5-His
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5840
  • Total vector size (bp) 8657
  • Vector type
    Mammalian Expression
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    HDAC7
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2817
  • GenBank ID
    EDL04222.1
  • Entrez Gene
    Hdac7 (a.k.a. 5830434K02Rik, HD7, HD7a, Hdac7a, mFLJ00062)
  • Tag / Fusion Protein
    • His/V5 (C terminal on backbone)

Cloning Information

  • Cloning method TOPO Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mHDAC7-Spliced (1-938) pEF6-V5 (MJS_014) [Edit] was a gift from Matthew Sweet (Addgene plasmid # 73267 ; http://n2t.net/addgene:73267 ; RRID:Addgene_73267)

  • For your References section:

    Histone deacetylase 7 promotes Toll-like receptor 4-dependent proinflammatory gene expression in macrophages. Shakespear MR, Hohenhaus DM, Kelly GM, Kamal NA, Gupta P, Labzin LI, Schroder K, Garceau V, Barbero S, Iyer A, Hume DA, Reid RC, Irvine KM, Fairlie DP, Sweet MJ. J Biol Chem. 2013 Aug 30;288(35):25362-74. doi: 10.1074/jbc.M113.496281. Epub 2013 Jul 12. 10.1074/jbc.M113.496281 PubMed 23853092
Related items:
Commonly requested with: