pLenti-CMV-mOC-STAMP-GFP
(Plasmid #73579)

• Purpose: Lentivirus expression of mOC-STAMP
• Depositing Lab: Paul Odgren
• Publication: Witwicka et al PLoS One. 2015 Jun 4;10(6):e0128275. doi: 10.1371/journal.pone.0128275. eCollection 2015.

Backbone

• Vector backbone: pLenti-CMV-MCS-GFP-SV-puro
• Backbone size w/o insert (bp): 8437
• Total vector size (bp): 9934
• Vector type: Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: OC-STAMP
• Species: M. musculus (mouse)
• GenBank ID: NM_029021.1
• Entrez Gene: Ocstamp (a.k.a. 4833422F24Rik, OC-STAMP)
• Tag / Fusion Protein:
  • GFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Xba1 (unknown if destroyed)
• 3′ cloning site: Xba1 (unknown if destroyed)
• 5′ sequencing primer: tcttaggcaatgtgcgtgcag

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry