Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pNIA-CEN-FLAG-LINXa4-Bre1
(Plasmid #73617)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 73617 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pNIA-CEN
  • Backbone size w/o insert (bp) 8084
  • Total vector size (bp) 10700
  • Vector type
    Yeast Expression, Synthetic Biology
  • Selectable markers
    LEU2

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LINXa4-Bre1dNLS
  • Species
    S. cerevisiae (budding yeast), Synthetic; Avena Sativa
  • Insert Size (bp)
    2616
  • Mutation
    Bre1 point mutations K8A, K9A and K11A
  • Promoter ADH1
  • Tag / Fusion Protein
    • FLAG (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site BamHI (unknown if destroyed)
  • 5′ sequencing primer GTCATTGTTCTCGTTCCCTTTCTTCCTTG
  • 3′ sequencing primer GGGACCTAGACTTCAGGTTGTCTAACTCC
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
  • Article Citing this Plasmid
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pNIA-CEN-FLAG-LINXa4-Bre1 was a gift from Brian Kuhlman (Addgene plasmid # 73617 ; http://n2t.net/addgene:73617 ; RRID:Addgene_73617)
  • For your References section:

    Light-induced nuclear export reveals rapid dynamics of epigenetic modifications. Yumerefendi H, Lerner AM, Zimmerman SP, Hahn K, Bear JE, Strahl BD, Kuhlman B. Nat Chem Biol. 2016 Jun;12(6):399-401. doi: 10.1038/nchembio.2068. Epub 2016 Apr 18. 10.1038/nchembio.2068 PubMed 27089030