NFATc2-CRISPR #1 (PX458-EF1a-pSpCas9(BB)-2A-GFP)
(Plasmid
#75232)
-
PurposeCRISPR/Cas9 plasmid against human NFATc2
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 75232 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonePX458-pSpCas9(BB)2A-GFP
-
Backbone manufacturerFeng Zhang (Plasmid #48138)
- Backbone size w/o insert (bp) 9703
- Total vector size (bp) 9703
-
Modifications to backboneCBH promoter exchanged for hEF1a promoter
-
Vector typeCRISPR
-
Selectable markersGFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesgRNA against NFATc2
-
Alt nameNFAT1
-
gRNA/shRNA sequence(gg)GCCGCAGAAGTTTCTGAGCG
-
SpeciesH. sapiens (human)
-
GenBank ID4773 (GENE-ID)
-
Entrez GeneNFATC2 (a.k.a. JCOSL, NFAT1, NFATP)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
gRNA contains at least 3 missmatches against human DNA (http://crispr.mit.edu) 2 additional nonmatching Guanidines added at 5' to enhnace specificy (Kim, D. et al. Digenome-seq: genome-wide profiling of CRISPR-Cas9 off-target effects in human cells. Nat. Methods 12, 237–43, 1 p following 243 (2015).)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
NFATc2-CRISPR #1 (PX458-EF1a-pSpCas9(BB)-2A-GFP) was a gift from Ria Baumgrass (Addgene plasmid # 75232 ; http://n2t.net/addgene:75232 ; RRID:Addgene_75232) -
For your References section:
Identification of Novel Nuclear Factor of Activated T Cells (NFAT)-Associated Proteins in T cells. Gabriel CH, Gross F, Karl M, Stephanowitz H, Hennig AF, Weber M, Gryzik S, Bachmann I, Hecklau K, Wienands J, Schuchhardt J, Herzel H, Radbruch A, Krause E, Baumgrass R. J Biol Chem. 2016 Sep 16. pii: jbc.M116.739326. 10.1074/jbc.M116.739326 PubMed 27637333