Skip to main content

H2B-pDendra2(N)
(Plasmid #75283)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 75283 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 75283-D50 50 μg of DNA in Tris buffer $495
DNA 75283-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pDendra2-N
  • Backbone manufacturer
    Evrogen
  • Backbone size w/o insert (bp) 4705
  • Total vector size (bp) 5105
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    H2bk
  • Alt name
    HIST1H2BK
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    378
  • GenBank ID
    NM_080593.2
  • Entrez Gene
    H2BC12 (a.k.a. H2B/S, H2BFAiii, H2BFT, H2BK, HIST1H2BK)
  • Promoter CMV
  • Tag / Fusion Protein
    • Dendra2 (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer CMV Forward CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Xavier Darzacq

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    H2B-pDendra2(N) was a gift from Xavier Darzacq (Addgene plasmid # 75283 ; http://n2t.net/addgene:75283 ; RRID:Addgene_75283)
  • For your References section:

    Single cell correlation fractal dimension of chromatin: a framework to interpret 3D single molecule super-resolution. Recamier V, Izeddin I, Bosanac L, Dahan M, Proux F, Darzacq X. Nucleus. 2014 Jan-Feb;5(1):75-84. doi: 10.4161/nucl.28227. Epub 2014 Feb 19. 10.4161/nucl.28227 PubMed 24637833