Skip to main content

pCas9-VRER_2A_GFP
(Plasmid #75475)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 75475 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pCAG
  • Backbone size w/o insert (bp) 4200
  • Total vector size (bp) 9271
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Cas9-VRER
  • Species
    Synthetic; human codon-optimized
  • Insert Size (bp)
    4137
  • Mutation
    D1135V, G1218R, R1335E, T1337R
  • Promoter CAG
  • Tag / Fusion Protein
    • 2A_GFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site None (destroyed during cloning)
  • 5′ sequencing primer ggctctagtgcctctgctaacc
  • 3′ sequencing primer M13R
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Plasmid is modified from pCas9_GFP, originally received from Addgene (Plasmid #44719), please check MTA for original plasmid.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCas9-VRER_2A_GFP was a gift from Marc Tessier-Lavigne (Addgene plasmid # 75475 ; http://n2t.net/addgene:75475 ; RRID:Addgene_75475)
  • For your References section:

    Efficient introduction of specific homozygous and heterozygous mutations using CRISPR/Cas9. Paquet D, Kwart D, Chen A, Sproul A, Jacob S, Teo S, Olsen KM, Gregg A, Noggle S, Tessier-Lavigne M. Nature. 2016 May 5;533(7601):125-9. doi: 10.1038/nature17664. Epub 2016 Apr 27. 10.1038/nature17664 PubMed 27120160