-
PurposeAll-in-one CRISPR/Cas9 vector with high-fidelity eSpCas9 expression in human pluripotent stem cells
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 79145 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneeSpCas9(1.1)
-
Backbone manufacturerAddgene #71814
- Total vector size (bp) 10243
-
Modifications to backboneAdded 2A-GFP to the C-terminal of eSpCas9(1.1) and replaced CBh promoter with CAG promoter
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameeSpCas9(1.1)
- Promoter CAG
-
Tag
/ Fusion Protein
- 2A-GFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (not destroyed)
- 3′ cloning site BbsI (not destroyed)
- 5′ sequencing primer ACTATCATATGCTTACCGTAAC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThis plasmid was modified from Addgene plasmid #71814 and contains GFP cassette.
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-eCas9-GFP-U6-gRNA was a gift from Jizhong Zou (Addgene plasmid # 79145 ; http://n2t.net/addgene:79145 ; RRID:Addgene_79145)