Skip to main content

hMYOD1-3xHA-IRES-hrGFP (#343)
(Plasmid #78327)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 78327 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 78327-D50 50 μg of DNA in Tris buffer $495
DNA 78327-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pIRES-2a-hrGFP
  • Backbone manufacturer
    Agilent Technologies
  • Backbone size w/o insert (bp) 5000
  • Total vector size (bp) 6000
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    MYOD1
  • Alt name
    Myogenic Differentiation 1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1000
  • GenBank ID
    NM_002478.4
  • Entrez Gene
    MYOD1 (a.k.a. CMYO17, CMYP17, MYF3, MYOD, MYODRIF, PUM, bHLHc1)
  • Promoter CMV
  • Tags / Fusion Proteins
    • 3x HA tag (C terminal on backbone)
    • IRES-hrGFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Not1 (not destroyed)
  • 3′ cloning site Xho1 (not destroyed)
  • 5′ sequencing primer AATTAACCCTCACTAAAGGG
  • 3′ sequencing primer CTATTAAGCGTAGTCAGGTACATC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please contact Dr. Alexander if you have any questions.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    hMYOD1-3xHA-IRES-hrGFP (#343) was a gift from Matthew Alexander & Louis Kunkel (Addgene plasmid # 78327 ; http://n2t.net/addgene:78327 ; RRID:Addgene_78327)