pFUChW nontargeting shRNA
(Plasmid
#78522)
-
PurposeLentiviral vector encoding shRNA and mCherry reporter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 78522 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepFUChW
- Backbone size w/o insert (bp) 10069
- Total vector size (bp) 10129
-
Modifications to backboneEGFP reporter in pFUGW replaced with mCherry
-
Vector typeLentiviral, RNAi
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemCherry
-
gRNA/shRNA sequenceNon-targeting shRNA
-
SpeciesM. musculus (mouse)
- Promoter UbC
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (unknown if destroyed)
- 3′ cloning site BsrGI (unknown if destroyed)
- 5′ sequencing primer TGTAATCATTTGGGTCAATATGTAA
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bymodified from Addgene plasmid 25870
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFUChW nontargeting shRNA was a gift from David Chan (Addgene plasmid # 78522 ; http://n2t.net/addgene:78522 ; RRID:Addgene_78522) -
For your References section:
Elimination of paternal mitochondria in mouse embryos occurs through autophagic degradation dependent on PARKIN and MUL1. Rojansky R, Cha MY, Chan DC. Elife. 2016 Nov 17;5. pii: e17896. doi: 10.7554/eLife.17896. 10.7554/eLife.17896 PubMed 27852436