pCRII-Topo U6-SpAi9L-U6SpDMDL
(Plasmid
#78608)
-
PurposeExpresses gRNAs (for SpCas9) targeting 5’ of Ai9 stop cassette and Dmd intron 22
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 78608 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepCR blunt II TOPO
-
Backbone manufacturerInvitrogen
- Total vector size (bp) 4495
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameU6-SpAi9L-U6SpDMDL
-
gRNA/shRNA sequenceAAAGAATTGATTTGATACCG; GAATAATTTCTATTATATTACA
-
SpeciesSynthetic
- Promoter U6
Cloning Information
- Cloning method TOPO Cloning
- 5′ sequencing primer TAA TAC GAC TCA CTA TAG GG
- 3′ sequencing primer GAT TTA GGT GAC ACT ATA G
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCRII-Topo U6-SpAi9L-U6SpDMDL was a gift from Amy Wagers (Addgene plasmid # 78608 ; http://n2t.net/addgene:78608 ; RRID:Addgene_78608) -
For your References section:
In vivo gene editing in dystrophic mouse muscle and muscle stem cells. Tabebordbar M, Zhu K, Cheng JK, Chew WL, Widrick JJ, Yan WX, Maesner C, Wu EY, Xiao R, Ran FA, Cong L, Zhang F, Vandenberghe LH, Church GM, Wagers AJ. Science. 2016 Jan 22;351(6271):407-11. doi: 10.1126/science.aad5177. Epub 2015 Dec 31. 10.1126/science.aad5177 PubMed 26721686
Map uploaded by the depositor.