pCRII-Topo U6-SpAi9R-U6-SpDMDR
(Plasmid
#78609)
-
PurposeExpresses gRNAs (for SpCas9) targeting 3’ of Ai9 stop cassette and Dmd intron 23
-
Depositing Lab
-
Depositing OrganizationHarvard University
Located in United States of America -
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 78609 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 78609-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 78609-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCR blunt II TOPO
-
Backbone manufacturerInvitrogen
- Total vector size (bp) 4495
-
Vector typeUnspecified
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameU6-SpAi9R-U6-SpDMDR
-
gRNA/shRNA sequenceGTATGCTATACGAAGTTATT; TTCGAAAATTTCAGGTAAGCCG
-
SpeciesSynthetic
- Promoter U6
Cloning Information
- Cloning method TOPO Cloning
- 5′ sequencing primer TAA TAC GAC TCA CTA TAG GG
- 3′ sequencing primer GAT TTA GGT GAC ACT ATA G
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 78609-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 78609-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCRII-Topo U6-SpAi9R-U6-SpDMDR was a gift from Amy Wagers (Addgene plasmid # 78609 ; http://n2t.net/addgene:78609 ; RRID:Addgene_78609) -
For your References section:
In vivo gene editing in dystrophic mouse muscle and muscle stem cells. Tabebordbar M, Zhu K, Cheng JK, Chew WL, Widrick JJ, Yan WX, Maesner C, Wu EY, Xiao R, Ran FA, Cong L, Zhang F, Vandenberghe LH, Church GM, Wagers AJ. Science. 2016 Jan 22;351(6271):407-11. doi: 10.1126/science.aad5177. Epub 2015 Dec 31. 10.1126/science.aad5177 PubMed 26721686
Map uploaded by the depositor.
