Skip to main content
Addgene
Open Menu

pX459_HR_Prnp_3
(Plasmid #78623)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 78623 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 78623-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 78623-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pX459
  • Total vector size (bp) 9178
  • Vector type
    Mammalian Expression, Mouse Targeting, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HR_Prnp_3
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Prnp (a.k.a. CD230, PrP, PrP<C>, PrPC, PrPSc, Prn-i, Prn-p, Sinc, prP27-30, prP33-35C)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer ACTATCATATGCTTACCGTAAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX459_HR_Prnp_3 was a gift from Walker Jackson (Addgene plasmid # 78623 ; http://n2t.net/addgene:78623 ; RRID:Addgene_78623)

  • For your References section:

    Manipulating the Prion Protein Gene Sequence and Expression Levels with CRISPR/Cas9. Kaczmarczyk L, Mende Y, Zevnik B, Jackson WS. PLoS One. 2016 Apr 29;11(4):e0154604. doi: 10.1371/journal.pone.0154604. eCollection 2016. PONE-D-16-11813 [pii] PubMed 27128441
Related items:
Commonly requested with: