BC-A1-005
(Plasmid
#78692)
-
PurposeA weak promoter drives the expression of wild type luxR, which regulates expression of LVA-tagged GFP under the control of a strong RBS.
-
Depositing Lab
-
Depositing OrganizationUniversity of Pennsylvania
Located in United States of America -
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 78692 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 78692-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 78692-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepSB1C3
-
Backbone manufacturerRegistry of Standardized Biological Parts
- Backbone size w/o insert (bp) 2047
- Total vector size (bp) 4132
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Turbo
-
Growth instructionsReporter gene expression can also be assayed at room temperature (~25C).
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBBa_J23109-BBa_B0034-luxR-Terminator-pLux-BBa_B0034-GFP(LVA)-Terminator
-
SpeciesSynthetic
-
Insert Size (bp)2085
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tgccacctgacgtctaagaa (VF2)
- 3′ sequencing primer attaccgcctttgagtgagc (VR)
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 78692-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 78692-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
BC-A1-005 was a gift from Brian Chow (Addgene plasmid # 78692 ; http://n2t.net/addgene:78692 ; RRID:Addgene_78692) -
For your References section:
Toolbox for Exploring Modular Gene Regulation in Synthetic Biology Training. Magaraci MS, Bermudez JG, Yogish D, Pak DH, Mollov V, Tycko J, Issadore D, Mannickarottu SG, Chow BY. ACS Synth Biol. 2016 Apr 25. 10.1021/acssynbio.6b00057 PubMed 27111289
Map uploaded by the depositor.
