Skip to main content

pCAGGS-Trex2
(Plasmid #79246)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 79246 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 79246-D50 50 μg of DNA in Tris buffer $495
DNA 79246-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pCAGGS
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Trex2
  • Species
    M. musculus (mouse)
  • GenBank ID
    NM_011907
  • Entrez Gene
    Trex2
  • Promoter pCAGGS

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer ttcctacagctcctgggcaacg
  • 3′ sequencing primer ttttggcagagggaaaaaga
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Expression vector for Trex2, which is a non-processive 3' exonuclease. Including co-expression of Trex2 with nucleases that induce site-specific chromosomal double strand breaks can cause elevated mutagenesis of the target site.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAGGS-Trex2 was a gift from Jeremy Stark (Addgene plasmid # 79246 ; http://n2t.net/addgene:79246 ; RRID:Addgene_79246)
  • For your References section:

    Limiting the persistence of a chromosome break diminishes its mutagenic potential. Bennardo N, Gunn A, Cheng A, Hasty P, Stark JM. PLoS Genet. 2009 Oct;5(10):e1000683. doi: 10.1371/journal.pgen.1000683. Epub 2009 Oct 16. 10.1371/journal.pgen.1000683 PubMed 19834534