pCAGGS-Trex2
(Plasmid
#79246)
-
PurposeExpression vector for Trex2, which is a non-processive 3' exonuclease.
-
Depositing Lab
-
Depositing OrganizationBeckman Research Institute of the City of Hope
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 79246 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 79246-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 79246-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCAGGS
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTrex2
-
SpeciesM. musculus (mouse)
-
GenBank IDNM_011907
-
Entrez GeneTrex2
- Promoter pCAGGS
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer ttcctacagctcctgggcaacg
- 3′ sequencing primer ttttggcagagggaaaaaga
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byExpression vector for Trex2, which is a non-processive 3' exonuclease. Including co-expression of Trex2 with nucleases that induce site-specific chromosomal double strand breaks can cause elevated mutagenesis of the target site.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 79246-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 79246-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAGGS-Trex2 was a gift from Jeremy Stark (Addgene plasmid # 79246 ; http://n2t.net/addgene:79246 ; RRID:Addgene_79246) -
For your References section:
Limiting the persistence of a chromosome break diminishes its mutagenic potential. Bennardo N, Gunn A, Cheng A, Hasty P, Stark JM. PLoS Genet. 2009 Oct;5(10):e1000683. doi: 10.1371/journal.pgen.1000683. Epub 2009 Oct 16. 10.1371/journal.pgen.1000683 PubMed 19834534
