pCAGGS-I-SceI-Trex2
(Plasmid #44024)

• Depositing Lab: Jeremy Stark
• Publication: Gunn et al J Biol Chem. 2011 Dec 9;286(49):42470-82. doi: 10.1074/jbc.M111.309252. Epub 2011 Oct 24.

Backbone

• Vector backbone: pCAGGS
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: I-SceI fused to mTREX2
• GenBank ID: NM_001184371 NM_011907
• Promoter: pCAGGS
• Tag / Fusion Protein:
  • NLS-HA (N terminal on insert)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: ttcctacagctcctgggcaacg
• 3′ sequencing primer: ttttggcagagggaaaaaga

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Mammalian expression vector for I-SceI-Trex2 fusion protein to generate site-specific non-cohesive chromosomal breaks. I-SceI generates a double strand break within its 18 base pair recognition site, leaving 4 nucleotide ssDNA overhangs. Trex2 is a non-processive 3' exonuclease that can degrade the I-SceI 3' overhang. Subsequent end joining repair causes efficient loss of chromosomal I-SceI sites.