pTag-RFP-C-h-Rab7L1-c-Myc
(Plasmid
#79804)
-
PurposeExpress TagRFP labeled human Rab7L1.
-
Depositing Lab
-
Depositing OrganizationUniversity of British Columbia
Located in Canada -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 79804 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 * | |
| DNA | 79804-D50 | 50 μg of DNA in Tris buffer | $495 * | ||
| DNA | 79804-D100 | 100 μg of DNA in Tris buffer | $585 * | ||
* Log in to view industry pricing.
Backbone
-
Vector backbonepTagRFP-C vector
-
Backbone manufacturerEvrogen
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameRab7L1
-
Alt nameRab29
-
SpeciesH. sapiens (human)
-
GenBank IDNM_003929.3
-
Entrez GeneRAB29 (a.k.a. RAB7L, RAB7L1)
- Promoter CMV
-
Tags
/ Fusion Proteins
- TagRFP (N terminal on backbone)
- myc (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer TagRFPmKate-F1 (AGGCCGACAAAGAGACCTAC)
- 3′ sequencing primer SV40pA-R
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 79804-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 79804-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTag-RFP-C-h-Rab7L1-c-Myc was a gift from James Johnson (Addgene plasmid # 79804 ; http://n2t.net/addgene:79804 ; RRID:Addgene_79804) -
For your References section:
Inter-domain tagging implicates caveolin-1 in insulin receptor trafficking and Erk signaling bias in pancreatic beta-cells. Boothe T, Lim GE, Cen H, Skovso S, Piske M, Li SN, Nabi IR, Gilon P, Johnson JD. Mol Metab. 2016 Feb 10;5(5):366-78. doi: 10.1016/j.molmet.2016.01.009. eCollection 2016 May. S2212-8778(16)00021-1 [pii] PubMed 27110488