Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #79806)


Item Catalog # Description Quantity Price (USD)
Plasmid 79806 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Species
    H. sapiens (human)
  • Entrez Gene
    RAB11A (a.k.a. YL8)
  • Promoter CMV
  • Tags / Fusion Proteins
    • TagRFP (N terminal on backbone)
    • myc (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer TagRFPmKate-F1 (AGGCCGACAAAGAGACCTAC)
  • 3′ sequencing primer SV40pA-R
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTag-RFP-C-h-Rab11a-c-Myc was a gift from James Johnson (Addgene plasmid # 79806 ; ; RRID:Addgene_79806)
  • For your References section:

    Inter-domain tagging implicates caveolin-1 in insulin receptor trafficking and Erk signaling bias in pancreatic beta-cells. Boothe T, Lim GE, Cen H, Skovso S, Piske M, Li SN, Nabi IR, Gilon P, Johnson JD. Mol Metab. 2016 Feb 10;5(5):366-78. doi: 10.1016/j.molmet.2016.01.009. eCollection 2016 May. S2212-8778(16)00021-1 [pii] PubMed 27110488