pCMV-160
(Plasmid
#79840)
-
PurposeExpresses NLS-PpsR2-mVenus under CMV promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 79840 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepEGFP-N1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4000
- Total vector size (bp) 6200
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNLS-PpsR2-mVenus
-
SpeciesRhodopseudomonas palustris
-
Insert Size (bp)2300
-
MutationRpPpsR2 cysteine 439 changed to serine
-
GenBank IDKX063612 CAE26978.1
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AsisI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer ggtaggcgtgtacggtgggag
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byA RpPpsR2 gene of R. palustris (NCBI Gene rpa1536) (accession code CAE26978) was provided by M. Papiz (Liverpool University, UK) and T. Beatty (University of British Columbia, Canada).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-160 was a gift from Vladislav Verkhusha (Addgene plasmid # 79840 ; http://n2t.net/addgene:79840 ; RRID:Addgene_79840) -
For your References section:
A bacterial phytochrome-based optogenetic system controllable with near-infrared light. Kaberniuk AA, Shemetov AA, Verkhusha VV. Nat Methods. 2016 May 9. doi: 10.1038/nmeth.3864. 10.1038/nmeth.3864 PubMed 27159085