pKA-142
(Plasmid #79835)

• Purpose: Expresses PpsR2-mVenus-CAAX under CMVd1 promoter
• Depositing Lab: Vladislav Verkhusha
• Publication: Kaberniuk et al Nat Methods. 2016 May 9. doi: 10.1038/nmeth.3864.

Backbone

• Vector backbone: pFC15K
• Backbone manufacturer: Promega
• Backbone size w/o insert (bp): 2800
• Total vector size (bp): 5000
• Vector type: Mammalian Expression
• Selectable markers: None

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: PpsR2-mVenus-CAAX
• Species: Rhodopseudomonas palustris
• Insert Size (bp): 2200
• Mutation: RpPpsR2 cysteine 439 changed to serine
• GenBank ID: KX063612 CAE26978.1
• Promoter: CMVd1

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AsisI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: ggtaggcgtgtacggtgggag
• 3′ sequencing primer: GCA TCA CAA ATT TCA CAA ATA AAG C

Resource Information

• Supplemental Documents:
  • pKA-142
• A portion of this plasmid was derived from a plasmid made by: A RpPpsR2 gene of R. palustris (NCBI Gene rpa1536) (accession code CAE26978) was provided by M. Papiz (Liverpool University, UK) and T. Beatty (University of British Columbia, Canada).
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry