pKA-144
(Plasmid
#79839)
-
PurposeExpresses RpBphP1-mCherry-Intersectin1 DHPH domain under CMVd1
-
Depositing Lab
-
Depositing OrganizationAlbert Einstein College of Medicine
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 79839 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepFC15K
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 2700
- Total vector size (bp) 6800
-
Vector typeMammalian Expression, Synthetic Biology
-
Selectable markersNone
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameRpBphP1-mCherry-Intersectin1 DHPH domain
-
SpeciesRhodopseudomonas palustris
-
Insert Size (bp)4100
-
GenBank IDNCBI Gene rpa1537 KX063613
- Promoter CMVd1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer ggtaggcgtgtacggtgggag
- 3′ sequencing primer GCA TCA CAA ATT TCA CAA ATA AAG C
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byRpBphP1 gene of R. palustris (NCBI Gene rpa1537) was provided by E. Giraud (Institute for Research and Development, France) A DHPH domain of human intersectin-1 was PCR amplified from a plasmid (Addgene #22278)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKA-144 was a gift from Vladislav Verkhusha (Addgene plasmid # 79839 ; http://n2t.net/addgene:79839 ; RRID:Addgene_79839) -
For your References section:
A bacterial phytochrome-based optogenetic system controllable with near-infrared light. Kaberniuk AA, Shemetov AA, Verkhusha VV. Nat Methods. 2016 May 9. doi: 10.1038/nmeth.3864. 10.1038/nmeth.3864 PubMed 27159085