pX330-sgRNA_Drosha_1
(Plasmid
#79860)
-
PurposeCRISPR/Cas9 DROSHA
-
Depositing Lab
-
Depositing OrganizationETH Zurich (Swiss Federal Institute of Technology)
Located in Switzerland -
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 79860 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepX330-U6-Chimeric_BB-CBh-hSpCas9
-
Backbone manufacturerAddgene 42230
- Backbone size w/o insert (bp) 8506
- Total vector size (bp) 8509
-
Vector typeMammalian Expression, Bacterial Expression, Mouse Targeting, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA Drosha
-
gRNA/shRNA sequenceCCCGCCCGTCATGCCGCAGC
-
SpeciesM. musculus (mouse)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX330-sgRNA_Drosha_1 was a gift from Constance Ciaudo (Addgene plasmid # 79860 ; http://n2t.net/addgene:79860 ; RRID:Addgene_79860) -
For your References section:
Noncanonical function of DGCR8 controls mESC exit from pluripotency. Cirera-Salinas D, Yu J, Bodak M, Ngondo RP, Herbert KM, Ciaudo C. J Cell Biol. 2017 Jan 18. pii: jcb.201606073. doi: 10.1083/jcb.201606073. 10.1083/jcb.201606073 PubMed 28100686