pMT-zic2a-cytoBirA-2A-mCherry_Ras
(Plasmid
#80064)
-
PurposeZic2a promoter driving HA-tagged biotin ligase (BirA), a Thosea asigna virus peptide (2A), and membrane-tethered mCherry protein (membCherry); flanked by Tol2 sequences
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 80064 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepMT
- Backbone size w/o insert (bp) 5450
- Total vector size (bp) 7509
-
Vector typeBacterial Expression ; zebrafish biotagging
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBiotin ligase (BirA), a Thosea asigna virus peptide (2A), and mCherry protein
-
SpeciesD. rerio (zebrafish)
-
Insert Size (bp)2059
- Promoter Zic2a enhancer driving c-fos promoter
-
Tag
/ Fusion Protein
- 3x HA (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer atttaggtgacactatagaagag
- 3′ sequencing primer taatacgactcactatagggag
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMT-zic2a-cytoBirA-2A-mCherry_Ras was a gift from Tatjana Sauka-Spengler (Addgene plasmid # 80064 ; http://n2t.net/addgene:80064 ; RRID:Addgene_80064) -
For your References section:
Biotagging of Specific Cell Populations in Zebrafish Reveals Gene Regulatory Logic Encoded in the Nuclear Transcriptome. Trinh LA, Chong-Morrison V, Gavriouchkina D, Hochgreb-Hagele T, Senanayake U, Fraser SE, Sauka-Spengler T. Cell Rep. 2017 Apr 11;19(2):425-440. doi: 10.1016/j.celrep.2017.03.045. 10.1016/j.celrep.2017.03.045 PubMed 28402863