-
PurposeGFP-dependent dGBP1-TagBFP, for expression in mammalian cells
-
Depositing Lab
-
Depositing OrganizationHarvard Medical School
Located in the United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 80086 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 80086-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 80086-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCAG-GFP
- Backbone size w/o insert (bp) 4823
- Total vector size (bp) 5889
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedGBP1-TagBFP
-
SpeciesSynthetic
-
Insert Size (bp)1059
- Promoter CAG
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GAGCCTCTGCTAACCATGTTC
- 3′ sequencing primer TAGCCAGAAGTCAGATGCTCAAG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please cite: Tang JC, Drokhlyansky E, Etemad B, Rudolph S, Guo B, Wang S, Ellis EG, Li JZ, Cepko CL (2016) Detection and manipulation of live antigen-expressing cells using conditionally stable nanobodies. Elife 5. doi:10.7554/eLife.15312
DNA (Catalog # 80086-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 80086-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-dGBP1-TagBFP was a gift from Connie Cepko (Addgene plasmid # 80086 ; http://n2t.net/addgene:80086 ; RRID:Addgene_80086) -
For your References section:
Detection and manipulation of live antigen-expressing cells using conditionally stable nanobodies. Tang JC, Drokhlyansky E, Etemad B, Rudolph S, Guo B, Wang S, Ellis EG, Li JZ, Cepko CL. Elife. 2016 May 20;5. pii: e15312. doi: 10.7554/eLife.15312. 10.7554/eLife.15312 PubMed 27205882
Map uploaded by the depositor.
