-
PurposeExpresses smURFP and Heme Oxygenase-1 in mammalian cells.
-
Depositing Labs
-
Depositing OrganizationUniversity of California, San Diego (UCSD)
Located in the United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 80345 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 80345-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 80345-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepcDNA3
-
Backbone manufacturerThermo Fisher
- Backbone size w/o insert (bp) 6842
- Total vector size (bp) 7712
-
Modifications to backboneContains Internal Ribosomal Entry Site (IRES) for expression of both smURFP and HO-I.
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namesmURFP
-
Alt namesmall Ultra-Red Fluorescent Protein
-
SpeciesSynthetic
-
Insert Size (bp)402
- Promoter CMV
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site HindII (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer Unnecessary
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameHO-1
-
Alt nameHeme Oxygenase-1
-
SpeciesSynechocystis
-
Insert Size (bp)723
- Promoter IRES
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site BsiWI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer gtggctgcttatggtgacaatc
- 3′ sequencing primer CCTCGACTGTGCCTTCTA
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byAll constructs with HO-1 was initially obtained from Professor J. Clark Lagarias (University of California, Davis).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 80345-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 80345-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3-smURFP-IRES-HO-1 was a gift from Erik Rodriguez & Roger Tsien (Addgene plasmid # 80345 ; http://n2t.net/addgene:80345 ; RRID:Addgene_80345) -
For your References section:
A far-red fluorescent protein evolved from a cyanobacterial phycobiliprotein. Rodriguez EA, Tran GN, Gross LA, Crisp JL, Shu X, Lin JY, Tsien RY. Nat Methods. 2016 Aug 1. doi: 10.1038/nmeth.3935. 10.1038/nmeth.3935 PubMed 27479328