-
Purposedonor vector for AAVS1 targeting (puromycin selection) and constitutive GFP-luciferase fusion protein expression
-
Depositing Lab
-
Depositing OrganizationKyoto University, Center for iPS Cell Research and Application
Located in Japan -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 80493 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 80493-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 80493-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepBluescript
- Backbone size w/o insert (bp) 3000
-
Modifications to backboneHomology arms for AAVS1; promoter-less SA-T2A-puro selection cassette
-
Vector typeMammalian Expression ; donor vector (human)
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGFPluc2
-
Alt nameGFP-luciferase fusion protein
-
SpeciesSynthetic
-
Insert Size (bp)2391
- Promoter CAG
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer AGCCTCTGCTAACCATGTTC
- 3′ sequencing primer ATTAGCCAGAAGTCAGATGC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Deleted T2 protospacer sequence in HA-R
DNA (Catalog # 80493-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 80493-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAVS1-P-CAG-GFPluc2 was a gift from Knut Woltjen (Addgene plasmid # 80493 ; http://n2t.net/addgene:80493 ; RRID:Addgene_80493) -
For your References section:
Engineering the AAVS1 locus for consistent and scalable transgene expression in human iPSCs and their differentiated derivatives. Oceguera-Yanez F, Kim SI, Matsumoto T, Tan GW, Xiang L, Hatani T, Kondo T, Ikeya M, Yoshida Y, Inoue H, Woltjen K. Methods. 2015 Dec 18. pii: S1046-2023(15)30181-X. doi: 10.1016/j.ymeth.2015.12.012. 10.1016/j.ymeth.2015.12.012 PubMed 26707206