pAAVS1-P-CAG-GFP
(Plasmid #80491)

• Purpose: donor vector for AAVS1 targeting (puromycin selection) and constitutive GFP expression
• Depositing Lab: Knut Woltjen
• Publication: Oceguera-Yanez et al Methods. 2015 Dec 18. pii: S1046-2023(15)30181-X. doi: 10.1016/j.ymeth.2015.12.012.

Backbone

• Vector backbone: pCR-TOPO
• Backbone size w/o insert (bp): 3000
• Modifications to backbone: Homology arms for AAVS1; promoter-less SA-T2A-puro selection cassette
• Vector type: Mammalian Expression ; donor vector (human)
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin and Kanamycin, 100 & 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: CAG-GFP
• Species: Synthetic
• Insert Size (bp): 2447
• Promoter: CAG

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SalI (not destroyed)
• 3′ cloning site: XhoI (destroyed during cloning)
• 5′ sequencing primer: AGCCTCTGCTAACCATGTTC
• 3′ sequencing primer: ATTAGCCAGAAGTCAGATGC

Resource Information

• Supplemental Documents:
  • Genbank
• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Constructed from Addgene plasmid #22075