TR-GFP-3'UTR-HP
(Plasmid #80596)

• Purpose: Expresses GFP from the CBA promoter. Includes a Csy4 target hairpin in the 3'UTR. Cloned into an Adeno-Associated Virus backbone for packaging into AAV.
• Depositing Lab: Aravind Asokan
• Publication: Borchardt et al RNA. 2015 Nov;21(11):1921-30. doi: 10.1261/rna.051227.115. Epub 2015 Sep 9.

Ordering

Item	Catalog #	Description	Quantity	Price (USD)
Plasmid	80596	Standard format: Plasmid sent in bacteria as agar stab	1	$75	Add to Cart

This material is available to academics and nonprofits only.

Backbone

• Vector backbone: TR-GFP
  (Search Vector Database)
• Backbone size w/o insert (bp): 5927
• Total vector size (bp): 5957
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Csy4 hairpin
• Species: Pseudomonas aeruginosa
• Insert Size (bp): 30
• Promoter: CBA

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (not destroyed)
• 3′ cloning site: ClaI (not destroyed)
• 5′ sequencing primer: cctgagcaaagaccccaacgagaagcg

Resource Information

• Terms and Licenses:
  • UBMTA
  • Ancillary Agreement for Plasmids Containing FP Materials
• Industry Terms:
  • Not Available to Industry