Skip to main content

pProm1_BCD1-GFP
(Plasmid #80649)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 80649 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 80649-D50 50 μg of DNA in Tris buffer $495
DNA 80649-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    N/A
  • Backbone manufacturer
    N/A
  • Total vector size (bp) 2353
  • Modifications to backbone
    n/a
  • Vector type
    p15A origin, constitutive promoter, KanR
  • Selectable markers
    Kanamycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH10B
  • Growth instructions
    Medium copy
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    GFP
  • Alt name
    sfGFP
  • Insert Size (bp)
    717
  • Mutation
    NONE
  • Promoter constitutive promoter

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer QB3284_Fwd CGATCCTCATCCTGTCTCTTGATC
  • 3′ sequencing primer QB3810_Rev CGAGCGTAGCGAGTCAGTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pProm1_BCD1-GFP was a gift from Nathan Hillson (Addgene plasmid # 80649 ; http://n2t.net/addgene:80649 ; RRID:Addgene_80649)
  • For your References section:

    PR-PR: cross-platform laboratory automation system. Linshiz G, Stawski N, Goyal G, Bi C, Poust S, Sharma M, Mutalik V, Keasling JD, Hillson NJ. ACS Synth Biol. 2014 Aug 15;3(8):515-24. doi: 10.1021/sb4001728. Epub 2014 Jan 14. 10.1021/sb4001728 PubMed 25126893