pGAPTrap-Luc2-IRESMeo
(Plasmid
#82509)
-
PurposeVector targeting the Firefly Luciferase (Luc2) gene to the GAPDH locus of human cells. It is expressed from a 2A sequence at the C terminus of GAPDH. Puromycin resistance is encoded by the Meo gene.
-
Depositing Lab
-
Depositing OrganizationMurdoch Children's Research Institute
Located in Australia -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 82509 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 82509-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 82509-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepGAPTrap
-
Vector typeMammalian Expression, Synthetic Biology
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLuc2-IRESMeo
-
SpeciesSynthetic
-
Insert Size (bp)3071
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Asc1 (destroyed during cloning)
- 3′ cloning site Cla1 (not destroyed)
- 5′ sequencing primer caacagggtggtggacctcatg
- 3′ sequencing primer cctcttcaaggggtctacatgg
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 82509-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 82509-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGAPTrap-Luc2-IRESMeo was a gift from Ed Stanley (Addgene plasmid # 82509 ; http://n2t.net/addgene:82509 ; RRID:Addgene_82509) -
For your References section:
GAPTrap: A Simple Expression System for Pluripotent Stem Cells and Their Derivatives. Kao T, Labonne T, Niclis JC, Chaurasia R, Lokmic Z, Qian E, Bruveris FF, Howden SE, Motazedian A, Schiesser JV, Costa M, Sourris K, Ng E, Anderson D, Giudice A, Farlie P, Cheung M, Lamande SR, Penington AJ, Parish CL, Thomson LH, Rafii A, Elliott DA, Elefanty AG, Stanley EG. Stem Cell Reports. 2016 Sep 1. pii: S2213-6711(16)30139-4. doi: 10.1016/j.stemcr.2016.07.015. 10.1016/j.stemcr.2016.07.015 PubMed 27594589
Map uploaded by the depositor.
