Skip to main content

pTRIPZ (M)-HT-Cbx7-ATLm
(Plasmid #82522)

  • Purpose
    Lentivirus vector. Expresses mutant Halotag-Cbx7-ATLm fusion proteins in mammalian cells. Cbx7 ATL mutation of RKR70-72, K75, and KR77-78 to AGA70-72, A75, and AG77-78.
  • Depositing Lab
  • Depositing Organization
    University of Colorado, Denver
    Located in the United States of America
  • Sequence Information

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 82522 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pTRIPZ (M)
  • Total vector size (bp) 13868
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Chromobox Homolog 7
  • Alt name
    Cbx7
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    756
  • Mutation
    mutation of RKR70-72, K75, and KR77-78 to AGA70-72, A75, and AG77-78
  • GenBank ID
    NM_175709
  • Entrez Gene
    CBX7
  • Promoter CMV
  • Tag / Fusion Protein
    • HaloTag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoR1 (unknown if destroyed)
  • 3′ cloning site Mlu1 (unknown if destroyed)
  • 5′ sequencing primer CGATCAGGTCCGGGTTGTCTTCTTG
  • 3′ sequencing primer ctcacggcgagcgctgccacgtca
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTRIPZ (M)-HT-Cbx7-ATLm was a gift from Xiaojun Ren (Addgene plasmid # 82522 ; http://n2t.net/addgene:82522 ; RRID:Addgene_82522)