Skip to main content
Addgene
Open Menu

pCAG-Venus-MDGA2
(Plasmid #82544)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 82544 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 82544-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 82544-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pCAG
  • Backbone size w/o insert (bp) 5093
  • Total vector size (bp) 7889
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    MDGA2
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    4192
  • Entrez Gene
    Mdga2 (a.k.a. Mamdc1)
  • Promoter chicken beta actin
  • Tag / Fusion Protein
    • Venus fluorescent protein (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GCGCCGCCGTCCCCTTCTCCATCTC
  • 3′ sequencing primer CCGGCTCGTATGTTGTGTGGAATTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG-Venus-MDGA2 was a gift from Alice Ting (Addgene plasmid # 82544 ; http://n2t.net/addgene:82544 ; RRID:Addgene_82544)

  • For your References section:

    Proteomic Analysis of Unbounded Cellular Compartments: Synaptic Clefts. Loh KH, Stawski PS, Draycott AS, Udeshi ND, Lehrman EK, Wilton DK, Svinkina T, Deerinck TJ, Ellisman MH, Stevens B, Carr SA, Ting AY. Cell. 2016 Aug 25;166(5):1295-1307.e21. doi: 10.1016/j.cell.2016.07.041. 10.1016/j.cell.2016.07.041 PubMed 27565350
Related items:
Commonly requested with: