-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 15259 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepNICE
- Backbone size w/o insert (bp) 4014
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNeuroligin 2 with insert A
-
Alt nameNlgn2A
-
Alt nameNlgn2
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2637
-
Entrez GeneNlgn2 (a.k.a. NL2, NLG2)
-
Tag
/ Fusion Protein
- HA (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer cgcaaatgggcggtaggcgtgt
- 3′ sequencing primer catttgtagaggttttacttgctt (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pNICE-NL2A was a gift from Peter Scheiffele (Addgene plasmid # 15259 ; http://n2t.net/addgene:15259 ; RRID:Addgene_15259) -
For your References section:
Alternative splicing controls selective trans-synaptic interactions of the neuroligin-neurexin complex. Chih B, Gollan L, Scheiffele P. Neuron. 2006 Jul 20. 51(2):171-8. 10.1016/j.neuron.2006.06.005 PubMed 16846852