Skip to main content

pNICE-NL2A
(Plasmid #15259)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 15259 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pNICE
  • Backbone size w/o insert (bp) 4014
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Neuroligin 2 with insert A
  • Alt name
    Nlgn2A
  • Alt name
    Nlgn2
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2637
  • Entrez Gene
    Nlgn2 (a.k.a. NL2, NLG2)
  • Tag / Fusion Protein
    • HA (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer cgcaaatgggcggtaggcgtgt
  • 3′ sequencing primer catttgtagaggttttacttgctt
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pNICE-NL2A was a gift from Peter Scheiffele (Addgene plasmid # 15259 ; http://n2t.net/addgene:15259 ; RRID:Addgene_15259)
  • For your References section:

    Alternative splicing controls selective trans-synaptic interactions of the neuroligin-neurexin complex. Chih B, Gollan L, Scheiffele P. Neuron. 2006 Jul 20. 51(2):171-8. 10.1016/j.neuron.2006.06.005 PubMed 16846852

Ready-to-use antibodies

Looking for antibodies related to this plasmid? Check out this option:

Learn More