Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pNICE-NL2(-)
(Plasmid #15246)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 15246 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pNICE
  • Backbone size w/o insert (bp) 4014
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Neuroligin 2(-)
  • Alt name
    Nlgn2(-)
  • Alt name
    Nlgn2
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2586
  • GenBank ID
    NM_198862
  • Entrez Gene
    Nlgn2 (a.k.a. NL2, NLG2)
  • Tag / Fusion Protein
    • HA (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer cgcaaatgggcggtaggcgtgt
  • 3′ sequencing primer aagcaagtaaaacctctacaaatg
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    NL2(-) cDNA clone is from Invitrogen
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pNICE-NL2(-) was a gift from Peter Scheiffele (Addgene plasmid # 15246 ; http://n2t.net/addgene:15246 ; RRID:Addgene_15246)
  • For your References section:

    Alternative splicing controls selective trans-synaptic interactions of the neuroligin-neurexin complex. Chih B, Gollan L, Scheiffele P. Neuron. 2006 Jul 20. 51(2):171-8. 10.1016/j.neuron.2006.06.005 PubMed 16846852